Исследование генетического сходства Poa nemoralis L. и Рoa palustris L. (Роасеае) на базе нуклеотидных последовательностей района ETS 18S-26S ядерной рибосомной ДНК | Вестн. Том. гос. ун-та. Биология. 2011. № 4 (16).

Исследование генетического сходства Poa nemoralis L. и Рoa palustris L. (Роасеае) на базе нуклеотидных последовательностей района ETS 18S-26S ядерной рибосомной ДНК

Для выявления генетического сходства был секвенирован район внешнего транскрибируемого спейсера (ETS) 18S-26S ядерной рибосомной ДНК у 10 представителей Pоа palustris L. и одного P. nemoralis L. Исследование выявило слабую изменчивость этого района. Сравнение с данными, полученными из GenBank, подтвердило тесные связи P. palustris не только с P. nemoralis, но и с P. glauca Vahl., P. laxa subsp. flexuosa (Sm.) Hyl. (который, как считается, произошел от гибридизации P. laxa with P. glаuca) и даже с P. lettermanii Vasey (sect. Abbreviatae Nannf. еx Tzvel.). Район ETS оказался слишком консервативным для исследования отношений между видами Роа, поэтому для этой цели должны быть испробованы другие методы.

Research of genetic similarity of Poa nemoralis L.and Рoa palustris L. (Роасеае), based on ETS of 18S-26S NR DNA sequence data..pdf Вестник ВведениеПопытка филогенетической реконструкции секции Stenopoa Dumort., проводившаяся на базе классических морфологических и эколого-географических методов, выявила ряд спорных мест и поставила множество вопросов, для разрешения которых требуется применение молекулярно-генетических методов. Одной из центральных проблем филогении секции являются родственные взаимоотношения двух мезоморфных видов - P. nemoralis L. и Р. palustris L. Н.Н. Цвелев [1], предполагая высокогорное происхождение мятликов, считает, что P. nemoralis и P. palustris более других видов секции приближаются к общим предковым типам, обитавшим в относительных высокогорьях конца палеогена, причем сформировались они по-разному и в разных поясах гор. Более специализированный P. nemoralis обитал в поясе тургайских листопадных лесов еще до спуска их на межгорные равнины, а менее специализированный P. palustris - в поясе южнотаежных лесов, располагавшемся выше. В конце миоцена в результате возросшей континентализации климата отдельные элементы уже спустившихся к тому времени на равнины тургайских лесов стали замещаться спускающимися с гор таежными элементами. В результате P. nemoralis, оказавшийся в числе наиболее устойчивых элементов тургайской флоры, вошел в состав плиоценовых смешанных лесов. Плейстоценовое смещение границ привело к массовой гибридизации между P. nemoralis и более светолюбивым P. palustris [1]. М.Г. Попов [2] высказал предположение, что P. nemoralis, лесной неморальный мятлик, в плейстоцене мигрировал на юг вместе с обедненными тургайскими лесами, где и остался в горно-лесных группировках в качестве плейстоценового реликта. Впоследствии в результате изменений рельефа и климата этот вид дал, по мнению П.Н. Овчинникова [3], целый ряд специализированных криофильных и ксерофильных альпийских и степных видов. P. palustris, по предположению Т.И. Серебряковой [4], является производным от лесного предка и представляет собой достаточно древний вид, возникший в результате «местной» адаптации к луговым условиям. Лесное происхождение P. nemoralis не вызывает сомнений, однако с лесным происхождением P. palustris согласиться трудно. Как уже отмечалось ранее, Н.Н. Цвелев совершенно справедливо заметил: если в пределах одного современного рода фестукоидных злаков имеются как лесные, так и луговые виды, не следует выводить одни из других, так как обе эти экологические группы произошли от общего высокогорного предка [5]. Более вероятным представляется перемещение P. palustris вниз не под пологом южнотаежных лесов, а по открытым участкам, опушкам лесов, вдоль рек и ручьев. Дальнейшая эволюция секции шла главным образом по пути ксероморфогенеза. Современные виды P. nemoralis и P. palustris, по-видимому, нельзя считать непосредственными родоначальниками других видов, но они более других сохранили черты строения древних предков. И P. nemoralis, и P. palustris в настоящее время отличаются очень высоким полиморфизмом, у них отмечаются наиболее высокие и разнообразные хромосомные числа. Это свидетельствует о том, что их эволюция продолжается в мезофильных условиях, а сами они уже не так примитивны, как их предки, давшие, вероятно, начало большинству видов cекции.В нашей стране и за рубежом проводилась большая работа по изучению мятликов, при этом пересматривалась и корректировалась и система рода, и система секции Stenopoa. Так, Е.Н. Пояркова [6], критически пересмотревшая систему рода в пределах флоры Украины с привлечением анатомических и других данных, предложила разделить секцию Stenopoa на две подсекции: Nemorales, объединяющую мезоморфные виды, и Steriles, включающую эволюционно более продвинутые ксероморфные виды секции. Эту точку зрения поддержала Н.С. Пробатова [7, 8]. Такое внутрисекционное подразделение подразумевает, что родство между P. nemoralis и P. palustris значительно более тесное, чем, например, между P. nemoralis и P. sterilis Bieb., c одной стороны, и P. palustris и P. stepposa (Kryl.) Roshev. - с другой.Изучение большой и сложной группы мятликов секции Stenopoa ставит под сомнение правомерность подразделения секции Stenopoa на подсекции Nemorales и Steriles. В свете изученных особенностей распределения качественных признаков, маркирующих родственные группы видов (длина язычка и характер поверхности оси колоска), представляется более вероятным, что лесной P. nemoralis и луговой P. palustris - наиболее древние виды этой секции - дали начало двум эволюционным линиям (рядам в понимании Комарова). Эти линии лишь частично объединялись в результате гибридизации, образовав сложные гибридные комплексы, рассматривающиеся как агрегаты P. x intricata Wein и P. urssulensis Trin. В дальнейшем обе линии дали ксероморфные виды, но сходство между ними, по-видимому, чисто конвергентное, основанное на сходстве адаптивных признаков, а не на признаках родства. Для того же, чтобы классификация отражала естественную историю группы, к чему мы по возможности стремимся, необходимо, как напоминают О. Солбриг и Д. Солбриг [9], чтобы все члены рассматриваемого таксона были близкородственными между собой и происходили от общего предка. Таким образом, возникает вопрос, как давно произошла дифференциация этих видов. Предложенная Н.Н. Цвелевым [5] схема эволюционных взаимоотношений, как и всякая гипотеза, нуждается в проверке альтернативным методом, и проверку следует начать с самого основания системы, т.е. постараться выявить степень генетических различий между видами P. nemoralis и P. palustris, предположительно лежащих в основании двух основных ветвей эволюционного дерева секции. Морфологически и габитуально эти виды очень сходны, и различия между ними значительно меньше, чем между ними и их ксероморфными дериватами, но не отражают глубины родственных отношений, а могут быть следствием конвергентного сходства. Для выявления глубины дифференциации видов и, следовательно, их положения в системе следует изучить их генетическую дифференциацию. Вместе с тем следует принять во внимание и то, что их генетическая близость может свидетельствовать не только об их относительно недавней дифференциации, но и о вторичном сближении, обусловленном массовой гибридизацией во время плейстоценовых смещений растительных зон. Для выявления степени генетических различий между морфологически близкими видами P. nemoralis и P. palustris было начато молекулярно-генетическое исследование видов секции. Надо отметить, что род мятлик к настоящему времени относительно неплохо изучен в молекулярно-генетическом отношении и продолжает изучаться. Тем не менее многочисленные работы Р. Соренг [10-12], Л.Дж. Джилеспи [13-16], А.В. Родионова и Н.Н. Носова [17-19 и др.] посвящены филогении рода в целом, а детальное исследование S. Stoneberg Holt [20, 21 др.] касается главным образом P. pratensis L. Специального молекулярно-генетического исследования секции Stenopoa не проводилось. Как отметили А.С. Антонов [22] и В.С. Шнеер [23], к настоящему времени среди исследованных последовательностей ДНК растений преобладаИсследованиеют хлоропластные, но большая часть наследственной информации сосредоточена в ядерном геноме. Кроме того, недостатком хлоропластной ДНК является ее унипарентальное наследование. Это приводит к тому, что при исследовании близких видов филогенетические деревья, реконструированные на основе этого участка, могут отличаться от таковых, полученных в результате исследования геномов с бипарентальным наследованием [23, 24]. Более объективные результаты дает исследование генов рибосомных РНК. Эти гены представлены длинными тандемными повторами. Каждый такой повтор включает 3 гена - 18S, 5.8S и 26S, разделенных внутренними транскрибируемыми спейсерами ITS1 и ITS2 (internal transcribed spacer). Снаружи от генов размещаются внешние транскрибируемые спейсеры (ETS). Разделяются эти транскрибируемые повторы нетранскрибируемыми спейсерами NTS (non-transcribed spacer) [25]. Последовательность ITS1 и ITS2 в настоящее время широко используется для исследования взаимоотношений близкородственных таксонов уровня семейства и выше [26], тем не менее, как отмечает В.С. Шнеер [23], на низких таксономических уровнях вариабельность этих участков становится слишком низкой. И действительно, исследования L.J. Gillespie с коллегами [27] не выявили различий между P. nemoralis и P. palustris по последовательности ITS1 и ITS2.Многие исследователи [23, 28, 29] указывают на более высокую изменчивость участка ETS. Б.Дж. Болдвин и С. Маркос [30] отмечают, что доля изменчивых и потенциально информативных сайтов на участке ETS от 1,3 до 2,4 раза выше, чем на ITS1 + ITS2, а Р. Асеведо-Розак с соавт. [31] показывает, что участок ETS на 34,4% более информативен, чем другие исследованные последовательности. T. Орландо c соавт. [32] объясняют это тем, что ETS и IGS находятся под меньшим давлением отбора, и это позволяет им лучше сохранять мутации и, следовательно, определять родственные отношения. Тем не менее ETS используется для филогенетических исследований значительно реже, чем ITS. Л.Дж. Джилеспи (личное сообщение) видит причину этого в том, что участок ETS много длиннее, чем ITS, и не имеет универсальных праймеров, т.е. праймеров, пригодных для большинства растений. Поэтому для каждой группы растений требуется подбирать свои праймеры, и это серьезно усложняет исследования.Поскольку известно, что исследование ITS1 и ITS2 последовательностей не выявляет различий между P. nemoralis и P. palustris [33], была предпринята попытка выявить ее с помощью анализа нуклеотидных последовательностей ETS (внешний транскрибируемый спейсер, расположенный между 26S и 18S рибосомной ядерной последовательности). Цель данного исследования - оценить степень генетического сходства между P. palustris и P. nemoralis. Поскольку ETS P. nemoralis уже была исследована [27], основное внимание было сосредоточено на P. palustris.Материалы и методики исследованияИсследования проведены в Центре коллективного пользования Томского государственного университета «Экоген» на десяти образцах P. palustris и - для сравнения - одном P. nemoralis, отобранных из природных популяций (табл. 1). ДНК выделяли из листьев, высушенных в силикагеле или взятых из гербарных материалов, по стандартной методике Doyle and Doyle [34] с небольшими модификациями. Небольшие кусочки листьев, взятых с гербарных образцов, растирались в фарфоровой ступке с 700 мкл СТАБ-буфера, затем жидкая фракция переносилась с помощью пипетки в пробирки.Т а б л и ц а 1 Исследованные популяции№ образцаМесто хранения ваучера [35]МестонахождениеМестообитаниеВидКоллектор09-61TOАлтай, окр. с. КибезеньОпушка елового лесаPoa nemoralisМ.В. Олонова08-47TOКузнецкий Алатау, урочище Айдат, приток Белого ИюсаБерег ручьяPoa palustrisМ.В. Олонова09-42TOТомск, р-н ул. ТорговойПустырь на пескеPoa palustrisА.Л. Эбель09-48TOТомская обл., Кожевниковский р-н, с. КиреевскОбрывистый берег рекиPoa palustrisА.Л. Эбель09-52TOАлтай, окр. с. АкташОпушка елового лесаPoa palustrisМ.В. Олонова09-93TOСкандинавияЛугPoa palustrisR.J. Soreng09-66KUZКемеровская обл., Чебулинский р-н, 3 км к СВ от с. ЧумайРазнотравный лугPoa palustrisС.А. Шереметова, Е.А. Буко09-69KUZГорная Шория, окр. пос. Усть-Анзас, берег р. МрассуПрибрежный галечникPoa palustrisС.А. Шереметова, Е.А. Буко09-72KUZКемеровская обл., Междуреченский р-н, Красногорский угольный разрезРазнотравно-злаковый лугPoa palustrisС.А. Шереметова, Е.А. Буко09-85TOЯкутия , Яно-Индигирский р-нРазнотравно-злаковый лугPoa palustrisЕ.Г. Николин09-98TOКрасноярский край, Канский р-н, окр. ж/д станции СолянкаОпушка березового лесаPoa palustrisМ.В. ОлоноваПримечание. TO - Гербарий им. П.Н. Крылова Томского государственного университета (г. Томск); KUZ - Гербарий Кузбасского ботанического сада Института экологии человека СО РАН (г. Кемерово).После добавления 10 мкл РНКазы пробирки встряхивались на вортексе в течение 5 с и затем в течение 80 мин инкубировались в термостате при 65ºС при периодическом мягком взбалтывании. Затем в пробирки добавлялось 700μл очистительного раствора «хлороформ-изоамиловый спирт», после чего содержимое перемешивалось в течение 20 мин на ротационном вортексе. Затем смесь центрифугировалась на максимальной скорости (13000об./с) в течение 5 мин, верхняя фракция (супернатант) переносилась в новую пробирку, и процедура очистки повторялась еще раз. Далее для осаждения ДНК добавлялось 350 мкл холодного изопропанола, содержимое встряхивалось на вортексе на минимальной скорости в течение 1 мин и центрифугировалось на максимальной скорости в течение 10 мин. После чего изопропанол аккуратно с помощью пипетки удалялся, а осажденная ДНК промывалась 350 μл 70%-ного этилового спирта. Затем спирт также удалялся и ДНК высушивалось на воздухе до полного испарения спирта. После этого ДНК растворяли в 100 мкл деионизированной воды, пробирки помещались на хранение в морозильную камеру и хранились при t -20°С. Для амплификации по совету Л.Дж. Джилеспи (личное сообщение) в качестве прямого праймера был использован RETS4_F (TGGCTACGCGAGCGCATGAG), подобранный специально Л.Дж. Джилеспи и коллегами для исследования мятликов [36], а обратного - 18S-R (AGACAAGCATATGACTACTGGCAGG), одного из стандартных праймеров. Праймеры были синтезированы фирмой «СибЭнзим» (г. Новосибирск). Реакционная смесь содержала однократный ПЦР-буфер (60 мМ Tris - HCl, 25 мM KCl, 10 мM 2 - меркаптоэтанол, 0,1%-ный Тритон Х - 100), 1,5 мM MgCl2, 200 мкM каждого dNTP, 1 единицу активности TaqДНК-полимеразы («СибЭнзим», г. Новосибирск), по 5 пмоль праймеров, 10 нг геномной ДНК и деионизованную воду до объема 15 мкл. Амплификацию проводили в программируемом термоциклере MJ Mini™ Personal Thermal Cycler (Bio-Rad, США). Условия амплификации: первичная денатурация ДНК - 3 мин при 94ºС, затем 35 циклов, включающих три этапа: 30 с при 94ºС, 30 с при 57ºС, 1 мин при 72ºС; финальная достройка цепей - 10 мин при 72ºС, затем охлаждение до 4ºС. Продукты амплификации разделяли в 1,5%-ном агарозном геле в однократном ТАЕ-буфере (0,04М трис-ацетат, 0,002М ЭДТА) при напряжении 100 V, окрашивали бромистым этидием (1мкг/мл), визуализировали в ультрафиолетовом свете и фотодокументировали. Оценку размеров фрагментов ДНК осуществляли относительно 100 bp + 1,5 kb ДНК-маркера («СибЭнзим»). Полученные изображения обрабатывали в программе Adobe®Photoshop® CS2. Продукты амплификации очищали с использованием набора GeneJet TM PCR Purification Kit (Ferments, EU).Секвенирование проводили на приборе 3130 Genetic Analyzer с использованием BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, США). Для редактирования нуклеотидных последовательностей применяли программу Sequencing Analysis 5.2 (Applied Biosystems, США). Анализ, выМ.равнивание последовательностей осуществляли с помощью программ SeqMan™ II и MegAlign™ (DNASTAR Inc.).Результаты исследования и обсуждениеПолученная ETS-матрица содержит 570 пар оснований. Сравнение нуклеотидных последовательностей показало высокую степень сходства районов ETS P. nemoralis и P. palustris. Тем не менее некоторые различия, явные и неявные, все же удалось установить. Явные различия были обнаружены в позициях нуклеотидов 44, 537, 538 и 562. В основном имели место транзиции (замена пурина на пурин или пиримидина на пиримидин), в одном случае была зарегистрирована трансверсия (замена пиримидина на пурин или пурина на пиримидин): в позиции 538 у P. nemoralis стоит R, что может означать аденин или гуанин, а у всех P. palustris, у которых отсеквенировался этот участок, на этом месте располагается цитозин). И, наконец, в позиции 44 у P. nemoralis была обнаружена делеция, а у P. palustris - аденин. Интерес представляет также 136-я позиция, где у P. nemoralis стоит цитозин, у образцов № 3, 5, 7 P. palustris - аденин, а у остальных образцов эта позиция выпадает вообще, т.е. имеют место и трансверсия, и делеция. Вместе с тем были обнаружены неявные различия. Так, в позиции 43 у P. palustris стоит цитозин, а у P. nemoralis - М, что может означать и цитозин, и тимин; в позиции 161 у P. palustris располагается гуанин, а у P. nemoralis - S, что может означать и гуанин, и цитозин. Однако, вероятнее всего, это ошибки идентификации нуклеотидов; такие сравнения не совсем корректны, поскольку у P. nemoralis исследовался всего один экземпляр, тем не менее некоторое представление о генетическом сходстве видов оно дает. Исследование полученных нуклеотидных последовательностей района ETS рибосомной ДНК P. palustris выявило невысокую изменчивость данного фрагмента. Всего у четырех образцов были выявлены хотя бы какие-то отличия. Наиболее изменчивым оказался этот фрагмент у образца № 5, собранного на Алтае. У него обнаружилось 8 замен, из них в позициях 111, 113, 316, 355 и 356 имели место транзиции, а в 535, 536 и 537 - трансверсии. В четырех позициях (316, 355, 356 и 537) наблюдались транзиции у образца 7 из Кемеровской области, транзиция в позиции 316 и делеция в позиции 537 были обнаружены в образце № 2 (Кузнецкий Алатау), и, наконец, делеция была выявлена в 89-й позиции образца №3 (г. Томск). Для выявления различий в нуклеотидной последовательности ETS P. nemoralis и P. palustris были привлечены данные Gen Bank Национального центра биотехнологической информации США [33] и программа для сравнивания последовательностей BLAST (basic local alignment search tool). Эта программа позволяет исследователю сравнивать интересующие его последовательности с последовательностями, хранящимися в базе данных [37]. Сравнения показали не только высокую степень сходства между P. palustrisи P. nemoralis (табл. 2), но также и сходство этих видов с P. glauca Vahl. (sect. Stenopoa), P. lettermanii Vasey (sect. Abbreviatae Nannf. Ex Tzvel.) и P. laxa subsp. flexuosa (Sm.) Hyl. Последний, по мнению R. Soreng [38], образовался в результате гибридизации P. glauca и P. laxa Haenke (ssect. Oreinos Asch. et Graеb.).Т а б л и ц а 2Степень генетического сходства исследованных сибирских P. nemoralis и P. palustris с близкими видами мятликов, представленными в GenBankАминокислотные последовательности района ETS рибосомной ДНК из GenBankСтепень сходства (max. ident.) с исследованными сибирскими образцами, %№Происхождение образцаВидP. nemoralisP. palustrisGQ324324.1CAN: Gillespie 5804P. glauca9899GQ324355.1BRNU: Hajkova et al. 2004-18P. nemoralis9798GQ324345.1US: Soreng & Soreng 7434P. lettermanii9797GQ324342.1Brochmann 2000-3 (1or 3)P. laxa subsp. flexuosa9798При этом надо отметить, что два последних вида, хотя и близки по происхождению к видам секции Stenopoa, относятся даже к другим секциям. ЗаключениеИсследование нуклеотидных последовательностей ETS рибосомной ДНК P. palustris показало слабое генетическое отличие по этому признаку не только от близкого вида P. nemoralis, но даже и от видов близких секций. Проведенное исследование показало, что участок ETS, как и ITS, недостаточно информативен для исследования родственных отношений на внутрисекционном уровне. Для решения задач на этом уровне следует попробовать другие методы молекулярного анализа. Авторы благодарны д-ру L.J. Gillespie (Музей естественной истории, г. Оттава, Канада) и д-ру T. Giraud (Университет Париж-Юг, Орсэ, Франция) за ценные советы; канд. биол. наук А.Л. Эбелю (Томский государственный университет, г. Томск); канд. биол. наук С.А. Шереметовой, канд. биол. наук Е.А. Буко (Кузбасский ботанический сад, г. Кемерово) и Е.Г. Николину (Институт биологических проблем криолитзоны СО РАН, г. Якутск) за предоставленные гербарные образцы P. palustris.

Ключевые слова

Роа palustris L, Poa nemoralis L., ETS, систематика, Роа palustris L., Poa nemoralis L., ETS

Авторы

ФИООрганизацияДополнительноE-mail
Храброва Наталья ВалерьевнаНациональный исследовательский Томский государственный университеткандидат биологических наук, старший научный сотрудник лаборатории эволюционной цитогенетики ОСП «Научно-исследовательский институт биологии и биофизики Томского государственного университета»center_cu@res.tsu.ru
Олонова Марина ВладимировнаНациональный исследовательский Томский государственный университетдоктор биологических наук, профессор кафедры экологического менеджмента Биологического институтаolonova @green.tsu.ru
Всего: 2

Ссылки

Soreng R.J. Poa L. - The Bluegrass // Flora of North. America north of Mexico / eds. by M.E. Barkworth, C.A. Capels, S. Long, L.K. Anderton, M. Piep. New York ; Oxford : Oxford Univ. Press, 2007. Vol. 24. P. 486-601.
Лукашов В.В. Молекулярная эволюция и филогенетический анализ. М. : Бином, 2009. 256 с.
Gillespie L.J., Soreng R.J., Jacobs S.W.L. Phylogenetic relationship of Australian Poa (Poaceae: Poinae), including molecular evidence for two new genera, Saxipoa and Sylvipoa //Austr. Syst. Bot. 2009. Vol. 22. P. 413-436.
Gen Bank. URL: http://www.ncbi.nlm.nih.gov
Фризен Н. Молекулярные методы, используемые в систематике растений. Барнаул : АзБука, 2007. 64 с.
Holmgren P.K., Holmgren N.H., Barnett L.C. Index Herbariorum: A global directory of public herbaria and associated staff. New York Botanical Garden's Virtual Herbarium. URL: http://sweetgum.nybg.org/ih
Orlando T., Rubio M.A., Sturm N. et al. Intergenetic and external transcribed spacers of ribosomal RNA genes in lizard-infecting Leishmania: molecular structure and phylogenetic relationship to mammal-infecting Leishmania in the subgenus Leishmania (Leishmania) // Mem. Inst. Rio de Janeiro : Oswaldo Cruz, 2002. Vol. 97. P. 100-107.
Acevedo-Rosas R., Cameron K., Sosa V., Pell S. A molecular phylogenetic study of Graptopetalum (Crassulaceae) based on ETS, ITS, RPL16, and TRNL-F nucleotide sequences // American Journal of Botany. 2004. Vol. 91. P. 1099-1104.
Baldwin B.G., Marcos S. Phylogenetic utility of the external transcriber spacer (ITS) of 18S-26S rDNA: congruence of ETS and ITS trees of Calycadenia (Compositae) // Molecular Phylogenetic and Evolution. 1998. Vol. 10. P. 449-463.
Morgan D.R. nrDNA external transscribed spacer (ETS) sequence data, reticulate evolution, and systematic of Machaeranthera (Asteraceae) // Syst. Bot. 2003. Vol. 28, № 1. Р. 179-190.
Linder C.R., Goertzen L.R., Heuvel B.V. et al. Phylogenetic utility at low taxonomic levels in Asteraceae and closely allied families // Molecular Phylogenetics and Evolution. 2000. Vol. 14. P. 285-303.
Gillespie L.J., Soreng R.J., Bull R. et al. Phylogenetic Relationships in Subtribe Poinae (Poaceae, Poeae) Based on Nuclear ITS and Chloroplast trnT-trnF Sequences // Botany. 2008. № 86. P. 938-967.
SpringerImages. URL: http://www.springerimages.com/Images/ LifeSciences
Baldwin B.G., Sanderson M.J., Porter J.M. et al. The ITS regoin of nuclear ribosomal DNA: a valuable source of evidence on Angiosperm Phylogeny // Ann. Missouri. Bot. Gard. 1995. Vol. 82. P. 247-277.
Hoggard G.D., Kores P.J., Molvary M., Hoggard R.K. The phylogeny of Gaura (Onagraceae) based on ITS, ETS, and trnL-F sequence data // American Journal of Botany. 2004. Vol. 91. P. 139-148.
Шнеер В.С. Краткий очерк способов получения, обработки и трактовки данных по последовательностям ДНК в систематике растений. II. Методы построения филогенетических деревьев и оценки их достоверности; о выборе таксонов и последовательностей ДНК для анализов // Ботанический журнал. 2005. Т. 90, № 3. С. 304-329.
Stoneberg Holt S. D., Horova L., Bureš P. Indel patterns of the plastid DNA trnL-trnF region within the genus Poa (Poaceae) // Journal of Plant Research. 2004. № 117. Р. 393-407.
Stoneberg Holt S. D., Horová L., Bureš P. et al. The trnL-F plastid DNA characters of three Poa pratensis (Kentucky bluegrass) varieties // Plant, Soil and Environment. 2005. № 51. Р. 94-99.
Антонов А.С. Основы геносистематики высших растений. М. : МАИК Наука / Интерпериодика, 2000. 135 с.
Носов Н.Н., Родионов А.В. Молекулярно-филогенетическое изучение взаимоотношений между представителями рода Poa (Poaceae) // Ботанический журнал. 2008. Т. 93, № 12. С. 1919-1936.
Родионов А.В., Носов Н.Н., Ким Е.С. и др. Происхождение полиплоидных геномов мятликов (Poa L.) и феномен потока генов между Северной Пацификой и субантарктическими островами // Генетика. 2010. Т. 46, № 12. С. 1598-1608.
Родионов А.В., Ким Е.С., Пунина Е.О. и др. Эволюция хромосомных чисел в трибах Aveneae и Poeae по данным сравнительного исследования внутренних транскрибируемых спейсеров ITS1 и ITS2 ядерных генов 45S рРНК // Ботанический журнал. 2007. Т. 92, № 1. С. 57-71.
Gillespie L.J., Soreng R.J. A phylogenetic analysis of the Bluegrass genus Poa based on cpDNA restriction site data // Syst. Bot. 2005. Vol. 30, № 1. P. 84-105.
Gillespie L.J., Archambault A., Soreng R.J. Phylogeny of Poa (Poaceae) based on trnTt-rnF sequence data: major clades and basal relationships // Aliso. 2007. Vol. 23. P. 420-434.
Gillespie L.J., Boles D. R. Phylogenetic relationships and infraspecific variation in Canadian Arctic Poa based on chloroplast DNA restriction site data // Can. J. Bot. 2001. Vol. 79. P. 679-701.
Gillespie L.J., Consaul L.L., Aiken S.G. Hybridisation and the origin of the arctic grass Poa hartzii (Poaceae): evidence from morphology and hloroplast DNA restriction site data // Can. J. Bot. 1997. Vol. 75. P. 1978-1997.
Soreng R.J. Chloroplast-DNA and biogeography in a reticulating group: study in Poa (Poaceae) // Amer. J. Bot. 1990. Vol. 77, № 11. Р. 1383-1400.
Soreng R.J., Davis J.I., Doyle J.J. A phylogenetic analysis of chloroplast DNA restriction site variation in Poaceae subfam. Pooideae // Pl. Syst. Evol. 1990. Vol. 172. P. 83-97.
Soreng R.J., Davis J.I. Phylogenetic structure in Poaceae subfamily Pooideae as inferred from molecular and morphological characters: misclassification versus reticulation // Grasses systematisc and evolution / eds. S.W. L. Jacobs, J. Everett. Melbourne, 2000. P. 61-74.
Солбриг О., Солбриг Д. Популяционная биология и эволюция. М. : Мир, 1982. 488 с.
Пробатова Н.С. Семейство мятликовые, или злаки // Сосудистые растения советского Дальнего Востока. Л., 1985. Т. 1. С. 89-382.
Пробатова Н.С. К вопросу о системе рода мятлик (Poa L.) в связи с изучением его дальневосточных представителей // Комаровские чтения. Владивосток, 1969. Вып. 15-17. С. 117-127.
Пояркова Е.Н. Мятлики флоры Украинской ССР : автореф. дис. ... канд. биол. наук. Харьков, 1965. 15 с.
Цвелев Н.Н. О роде мятлик (Poa L.) в СССР // Новости систематики высших растений. 1974. Т. 11. С. 24-41.
Серебрякова Т.И. Побегообразование и жизненные формы некоторых мятликов (Poa L.) в связи с их эволюцией // Ботанический журнал. 1965. Т. 50, № 11. С. 1536-1556.
Овчинников П.Н. Основные направления видообразования в связи с происхождением типов растительности Средней Азии // Труды АН Таджикской ССР. 1955. Вып. 31. С. 19-33.
Попов М.Г. Флора Средней Сибири. М. ; Л. : Изд-во АН СССР, 1957. Т. 1. 555 с.
Цвелев Н.Н. К систематике мятликов (Poa L.) европейской части СССР // Новости систематики высших растений. 1972. Т. 9. С. 47-54.
 Исследование генетического сходства <i>Poa nemoralis </i>L. и <i>Рoa palustris </i>L. (Роасеае) на базе нуклеотидных  последовательностей района ETS 18S-26S ядерной рибосомной ДНК | Вестн. Том. гос. ун-та. Биология. 2011. № 4 (16).

Исследование генетического сходства Poa nemoralis L. и Рoa palustris L. (Роасеае) на базе нуклеотидных последовательностей района ETS 18S-26S ядерной рибосомной ДНК | Вестн. Том. гос. ун-та. Биология. 2011. № 4 (16).

Полнотекстовая версия