Конструирование перспективных онколитических рекомбинантных аденовирусов, экспрессирующих ген белка апоптина | Вестн. Том. гос. ун-та. Биология. 2013. № 3 (23).

Конструирование перспективных онколитических рекомбинантных аденовирусов, экспрессирующих ген белка апоптина

Осуществлен дизайн последовательностей гена белка апоптина, промоторов hTERT, CMV и конструирование несущих их рекомбинантных плазмид. С использованием методологии гомологичной рекомбинации и котрансфекции клеток получены два рекомбинантных аденовируса AdAE1a-hT-Apo и AdAE1a-CM-Apo с инсерциями гена белка апоптина под контролем hTERT- и CMV-промоторов и дефектных по репликации в эукариотических клетках. Третий рекомбинантный аденовирус AdhTE1a-CM-Apo содержит инсерцию гена апоптина и ген Е1А под контролем hTERT-промотора и делецию гена Е1В-55К, что должно обеспечивать ему высокий уровень селективной литической активности в отношении раковых клеток. Полученные аденовирусные векторы могут служить основой для создания перспективных онколитических препаратов, обладающих высокой специфичностью благодаря контролю вирусной репликации hTERT-промотором, а также высокой онколитической активности, обусловленной наличием гена белка апоптина, вызывающего р53- и bcl-2-независимый апоптоз опухолевых клеток.

The construction of recombinant adenoviruses expressing apoptin.pdf Введение Несмотря на успехи, достигнутые в терапии злокачественных новообразований с применением классических методов лечения, таких как хирургия, радио- и химиотерапия, прогресс их применения в настоящее время представляется достигшим своего предела. В связи с этим актуальной задачей является разработка новых методов противоопухолевой терапии. Одним из таких перспективных и бурно развивающихся направлений является применение онколитических аденовирусов. Данное семейство вирусов зарекомендовало себя в качестве эффективных и безопасных противоопухолевых агентов, обладающих рядом преимуществ по сравнению с другими семействами вирусов. Задачи, стоящие перед исследователями, конструирующими эффективные онколитические вирусы, заключаются, во-первых, в повышении их специфичности с целью избежать поражение нормальных клеток организма, во-вторых - в усилении их литических свойств для полного уничтожения всех раковых клеток в организме. Один из наиболее эффективных путей по усилению специфичности он-колитических аденовирусов является использование опухолеспецифиче-ских промоторов, один из которых, промотор обратной транскриптазы по-лимеразы (hTERT), показал себя как эффективный инструмент для контроля аденовирусной репликации [1, 2]. Для усилении онколитического потенциала аденовирусов в геном последних вводят различные трансгены, продукты которых могут усиливать литическую активность вирусов, участвовать в индукции противоопухолевого иммунного ответа или выполнять какие-либо другие функции, приводящие к более эффективному уничтожению опухолевых клеток. Одним из перспективных онколитических трансгенов является ген апоптоз-индуцирующего белка апоптина (продукт генома вируса анемии цыплят), индуцирующего р53- и bol-2-независимый апоптоз клеток. Было показано, что экспрессия гена апоптина в клетках сопровождается индукцией апоптоза исключительно опухолевых клеток [3, 4], что позволяет встраивать данный ген под контроль более сильных, нежели опухолевоспе-цифичные, промоторов, например цитомегаловирусного (PCMV). Цель исследования - конструирование перспективных онколитических ре-комбинатных аденовирусов со встроенным геном белка апоптина, отличающихся по используемым промоторам, контролирующим его экспрессию (hTERT и PCVM), а также по способности вирусов к репликации (репликативно-дефект-ных и компетентных по репликации, контролирующейся hTERT-промотором). Материалы и методики исследования Клетки и вирусы. В работе были использованы культуры клеток НЕК293 (клетки почки эмбриона человека, трансформированные генами Е1А и Е1В аденовируса человека 5-го серотипа), HEp2 (эпителиальная карцинома гортани человека), аденовирус человека 5-го серотипа (Ad5), полученный из Государственной коллекции вирусных штаммов при Институте вирусологии им. Д.И. Ивановского РАМН. Конструирование рекомбинантных аденовирусов. Последовательность коровой части промотора hTERT длиной 236 п.н. синтезировали методом элонгации праймеров в ПЦР согласно Li X. et al. [2]. Для синтеза были рассчитаны, химически синтезированы и использованы следующие праймеры: F1 GGCCAGGCCGGGCTCCCA R1 CGCGGGGGTGGCCGGGGC F2 GGCCAGGCCGGGCTCCCAGTGGATTCGCGGGCACAGACGCCCAGGACCGCGCTCCCCACGT R2 GAAGGGGCAGGACGGGTGCCCGGGTCCCCAGTCCCTCCGCCACGTGGGGAGCGCGGTCC F3 CACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCC CGACCCCTCCCG R3 GGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGG GTCGGGACG F4 CCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCA GCGCTGC R5 CGCGGGGGTGGCCGGGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAA ACTCGC Синтез гена белка апоптина с последовательностью репортерного пептида осуществляли методом элонгации праймеров в ПЦР. С этой целью по прототипной последовательности гена белка VP3 (апоптин) вируса анемии цыплят (GenBank P54094) были рассчитаны, химически синтезированы и использованы следующие праймеры: F1B AC C T TAGGAAAAT T T GGC CAACAAT C C GGAATGAACGCTCTCCAAGAAGATACTC-CACCCGGACCATCAACGGTG R1A GAGGGGT T T C CAAC GGC C GT GAAC T T GT T GGT GGC C T GAACAC C GT T GAT GGT C C-GGGTGGAGT F2A CAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTATCGCT R2A TCGCGCAGCCACACAGCGATAGAGTGATTGTAATTCCAGCGATAATCCGGATCTCTCT F3A TCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGATCTGCAACTGCGGA-CAATTCAGAA R3A GGGTTGATCGGTCCTCAAGTCCGGCACATTCTTGAAACCAGTGCTTTCTGAATTGTC-CGCAGTTGCAGA F4A CTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAG-TACAGGGTAAGCGAGCTAAAAGAA R4A-End TTACAGTCTTATACACCTTCTTGCGGTTCGGGGTCGGCTGGGAGTAGTGGTAAT-CAAGCTTTCTTTTAGCTCGCTTACCCTG R4A-add ATTTTCCTAAGGTTGTTATGGTAGCTCTCAGTCTTATACACCTTCTTGCGGT Для получения фрагмента аденовирусного генома с 459 по 2178 п.н., несущего последовательности генов Е1А и Е1В-19К, использовали следующие праймеры: F1-hTERT-E1a-Ad5 GCCCCGGCCACCCCCGCGATGAGACATATTATCTGCCACGGA R1-E1b-19K-Ad5 AGTTCTGGATACAGTTCAGCCACCT Фрагмент ДНК 601 п.н., содержащий промотор CMV, получали с использованием плазмиды pcDNA4 методом ПЦР с помощью праймеров: Fpcmv GTTGACATTGATTATTGACTAGTTATTA Rpcmv C C TAGT TAGC CAAGAGAGC T C T GC Для клонирования в аденовирусный геном использовали наборы ViraPover Adenoviral Gateway Expression Kit и TOPO TA Cloning, «Invitrogen» (США). Генные кассеты, содержащие последовательности гена белка апоптина под контролем промотора hTERT, гена белка апоп-тина под контролем промотора CMV и гена Е1А под контролем промотора hTERT + ген белка апоптина встраивали в промежуточную плазмиду pCR2.1. В результате были получены плазмиды pCR2.1-hT-Apo, pCR2.1-CM-Apo и pCR2.1-hTE1a-CM-Apo соответственно. На следующем этапе, с использованием LR Clonase™ II и клеток E. coli T1, проводили рекомбинацию вышеуказанных промежуточных плазмид с векторной плазмидой, несущей последовательности аденовирусного генома pAd/CMV/V5-DESTTM. Рекомбинантные клоны E. coli T1, содержащие плазмиды, несущие вставки гена апоптина, отбирали на основании ПцР-анализа с использованием праймеров: T7 promoter/priming site TAATACGACTCACTATAGGG V5(C-term) reverse priming site ACCGAGGAGAGGGTTAGGGAT Правильность сборки полученных конструкций подтверждали секвени-рованием на генетическом анализаторе ABI3130xl. Для проведения трансфекции эукаритических клеток плазмидные ДНК были наработаны в препаративных количествах и очищены от эндотоксинов с использованием набора реагентов «EndoFree Plasmid Maxi Kit», «QIAGEN» (США). После подтверждения наличия и правильности целевых инсерций в векторных плазмидных ДНК секвенированием проводили трансфекцию клеток НЕК293. Использовали реагент для трансфекции Lipofectamine™ LTX и реагент Plus «Invitrogen» (США). Трансфекцию проводили в шестилуночных культуральных планшетах смесью соответствующей векторной плазмидной ДНК (pAd/CMV/V5-DEST-AdДE1a-hT-Аpo, pAd/CMV/V5-DEST-AdДE1a-CM-Аpo или pAd/CMV/V5-DEST-AdhTE1a-CM-Аpo) гидролизованной эдонуклеазой рестрикции PacI в присутствии реагентов для трансфекции (2,5 мкг плазмидной ДНК + липофектамин, 10 мкл + реагент Plus, 3,5мкл) в соответствии с рекомендациями производителя в 1 мл среды Opti-MEM (Invitrogen, USA). После 6 ч инкубации клеток с трансфекционной смесью при 37°С в лунки добавляли еще 2 мл среды Opti-MEM и инкубировали при 37°С в атмосфере 5% СО2 4-8 сут до развития вирусиндуцированного цитопатического действия (ЦПД). Освобожденный из клеток трехкратным замораживанием - оттаиванием вирус клонировали методом бляшек на культуре клеток НЕК293, после чего проводили наработку вирусного потомства отдельных клонов. Рекомбинантный генотип полученных аденовирусов подтверждали ПцР-анализом и частичным секвенированием вирусных геномных ДНК. Для подтверждения наличия инсерции трансгена рассчитывали две пары праймеров: одна пара лежит во фланкирующих место встройки последовательностях аденовирусного генома, вторая включает праймер, лежащий внутри трансгена, и праймер на геномной последовательности, тем самым осуществляя привязку встройки к определенному району вирусного генома. Расчет структур праймеров выполняли в среде ПО «Vector NTI v.9.1» производства «Madison Inc.» (США), специфичность полученных последовательностей оценивали, используя программу «BLAST», интегрированную в систему базы данных «GenBank». Обработку и анализ нуклеотидных последовательностей проводили в среде ПО «Vector NTI v.9.1» производства «Madison Inc.» (США) и ПО секвенато-ра «ABI 3130xl» (США). Результаты исследования и обсуждение В ходе данной работы предполагалось сконструировать три варианта аденовирусных векторов, несущих встройки гена белка апоптина. Первые две конструкции обеспечивают создание репликативно-дефектных аденовирусов, в геноме которых делетирован ген Е1А, абсолютно необходимый для репликации вируса. В первом случае ген белка апоптина был встроен под контроль промотора обратной транскриптазы теломеразы (hTERT), а во втором - под контроль промотора цитомегаловируса. Третья конструкция представляет собой репликативно-компетентный вектор, в котором отсутствует область, кодирующая белок E1B-55K, а активация E1A возможна только в присутствии теломеразы, в связи с чем репликация данного аденовируса ограничивается опухолевыми клетками [2, 5]. На рис. 1 представлены схемы генома сконструированных аденовирусных векторов. Для создания конструкций, представленных на рис. 1, были синтезированы целевые последовательности, осуществлен их дизайн и сконструированы генные кассеты, обеспечивающие интеграцию трансгенов в аденовирусный геном. Синтез трансгенов осуществляли по опубликованным последовательностям промотора hTERT [2] и гена белка апоп-тина (GenBank P54094). Последовательность коровой части промотора hTERT длиной 236 п.н. синтезировали методом элонгации праймеров в ПцР. Амплифицированная последовательность промотора hTERT была секвенирована и полностью соответствовала литературным данным по нуклеотидной последовательности промотора hTERT. Синтез гена белка апоптина с последовательностью репортерного пептида осуществляли методом элонгации праймеров в ПЦР. Фрагмент ДНК длиной 601 п.н., содержащий промотор CMV, получали с использованием плазмиды pcD-NA4 методом ПцР. Рис. 1. Схема геномной организации сконструированных рекомбинантных аденовирусов: 1 - дефектный по репликации аденовирус с делетированными генами Е1А и Е1В с инсерцией гена апоптина под контролем hTERT-промотора; 2 - дефектный по репликации аденовирус с делетированными генами Е1А и Е1В с инсерцией гена апоптина под контролем CMV-промотора; 3 - компетентный по репликации аденовирус с геном Е1А под контролем hTERT-промотора (несущий делецию гена Е1В-55К) с инсерцией гена апоптина по контролем CMV-промотора. pA - сигнал полиаденилирования С целью последующего конструирования компетентного по репликации рекомбинантного аденовируса, экспрессирующего трансген и несущего делецию гена Е1В-55К, методом ПЦР с использованием геномной ДНК аденовируса 5-го серотипа в качестве матрицы амплифицировали фрагмент аденовирусного генома с 459 по 2178 п.н., включающий последовательность генов Е1А и Е1В-19К. На следующем этапе полученные фрагменты кДНК гена белка апопти-на (444 п.н.), CMV-промотора (601 п.н.), промотора hTERT (236 п.н.) и генов Е1А и Е1В-19К аденовируса 5-го серотипа (1719 п.н.) методом ПЦР-лигирования собирали в генные кассеты и клонировали в промежуточную плазмиду pCR2.1TOPO. В результате были получены плазмиды pCR2.1-hT--Apo, pCR2.1-CM-Apo и pCR2.1-AdhTE1a-CM-Apo. Сконструированные генные кассеты методом 5'- и 3'-концевого удлинения праймеров в ПЦР фланкировали последовательностями attB1 и attB2 и клонировали в векторную плазмиду pAd/CMV/V5-DEST, несущую аденовирусный геном, методом гомологичной рекомбинации к клетках E. coli T1. Рекомбинантные клоны E. coli T1, содержащие рекомбинантные плазмиды, отбирали на основании ПЦР и рестрикционного анализа. Были получены векторные плазмиды, несущие аденовирусный геном, и встроенные генные кассеты: pAd/ CMV/V5-DEST-AdAE 1 a-hT-Apo, pAd/CMV/V5-DEST-AdAE1a-CM-Apo и pAd/CMV/V5-DEST-AdhTE1a-CM-Apo. Наличие и правильность целевых инсерций в векторных плазмидных подтверждены секвенированием, после чего проводили трансфекцию клеток НЕК293. Для контроля эффективности трансфекции использовали аденовирусную ДНК в комплексе с терминальным белком, выделенную из рекомбинантного варианта аденовируса Adel2, делеционного по гену Е1В-55К [6, 7]. Типичное для клеток НЕК293 аденовирусное цПД было выявлено на 4-е сут для контрольной аденовирусной ДНК Adel2, на 6-е и 8-е сут для векторных плазмидных ДНК pAd/ CMV/V5-DEST-AdДE1a-hT-Аpo и pAd/CMV/V5-DEST-AdhTE1a-CM-Аpo соответственно. Появление вирусиндуцированного цПД в монослое клеток НЕК293, трансфецированных векторной ДНК pAd/CMV/V5-DEST-AdДE1a-CM-Аpo, выявлено при выполнении пересева («слепого» пассажа) трансфецированных клеток. На рис. 2 приведены фотографии трансфецированных плазмидными и аденовирусной ДНК клеток НЕК293 с типичными проявлениями аденовирусного цПД. Рис. 2. Вирусиндуцированное ЦПД клеток НЕК293, трансфецированных векторными плазмидными и аденовирусной Adel2 ДНК: 1 - контрольный монослой клеток НЕК293; 2 - клетки НЕК293, трансфецированные ДНК рекомбинантного аденовируса Adel2; 3 - клетки НЕК293, трансфецированные векторной плазмидной ДНК pAd/CMV/V5-DEST-AdhTE1a-CM-Аpo; 4 - клетки НЕК293, трансфецированные векторной плазмидной ДНК pAd/CMV/V5-DEST-AdДE1a-hT-Аpo Полученные рекомбинантные аденовирусы были клонированы методом бляшек. Инфекционную активность рекомбинантных аденовирусов определяли титрованием на клетках НЕК293. Для определения фенотипа (репликационно-компетентный или дефектный) проводили параллельное титрование сконструированных рекомбинантных аденовирусов на культуре клеток HEp2 (не комплементирующая дефект аденовирусного гена Е1А перевиваемая линия эпителиальных клеток гортани человека, чувствительная к аденовирусной инфекции). В качестве контрольного рекомбинантного аденовируса использовали делеционный по гену Е1В-55К аденовирус Adel2. Результаты приведены в таблице, инфекционный титр рекомбинантных аденовирусов выражали через ТЦПД50/мл (50%-ная тканевая ци-топатическая доза) [8]. Как видно из табл. 1, рекомбинатные аденовирусы AdAE1a-hT-Apo и AdAE1a-CM-Apo инфицируют с высокой активностью комплементарные клетки НЕК293 и в то же время не способны к эффективной репликации в культуре клеток HEp2, что свидетельствует о репли-кационно-дефектном фенотипе этих двух рекомбинантов. Рекомбинатный аденовирус AdhTE1a-CM-Apo способен эффективно инфицировать как клетки НЕК293, так и НЕр2 (с активностью, близкой к таковой рекомби-нанта Adel2) и соответственно является компетентным по репликации аденовирусом. Способность AdhTE1a-CM-Apo инфицировать клетки НЕр2 обусловлена, по-видимому, тем, что данная клеточная культура является перевиваемой (иммортализованной) и характеризуется повышенным уровнем теломеразной активности. Инфекционная активность сконструированных рекомбинатных аденовирусов Аденовирус Инфекционный титр для клеточной культуры, ТЦПД,о/мл НЕК293 НЕр2 AdAE1a-hT-Apo 1010

Ключевые слова

apoptosis, hTERT promoter, oncolytic viruses, apoptin, adenovirus, recombinants, апоптоз, hTERT-промотор, онколитические вирусы, апоптин, рекомбинанты, аденовирус

Авторы

ФИООрганизацияДополнительноE-mail
Нетесов Сергей ВикторовичНовосибирский государственный университетчл.-кор. РАН, профессор, доктор биологических наук, зав. лабораторией бионанотехнологийnauka@nsu.ru
Локтев Валерий БорисовичГосударственный научный центр вирусологии и биотехнологии «Вектор» (р.п. Кольцово, Новосибирская область)доктор биологических наук, профессор, зав. отделом молекулярной вирусологии флавивирусов и вирусных гепатитовvaleryloktev@gmail.com
Чумаков Петр МихайловичИнститут молекулярной биологии им. В.А. Энгельгардта Российской академии наук (г. Москва)профессор, доктор биологических наук, зав. лабораторией пролиферации клетокchumakov@yahoo.com
Протопопова Елена ВикторовнаГосударственный научный центр вирусологии и биотехнологии «Вектор» (р.п. Кольцово, Новосибирская область)кандидат биологических наук, ведущий научный сотрудник отдела молекулярной вирусологии флавивирусов и вирусных гепатитовprotopopova_ev@vector.nsc.ru
Микрюкова Тамара ПетровнаГосударственный научный центр вирусологии и биотехнологии «Вектор» (р.п. Кольцово, Новосибирская область)кандидат биологических наук, научный сотрудник лаборатории молекулярной эпидемиологии особо опасных инфекций отдела молекулярной вирусологии флавивирусов и вирусных гепатитовmikryukova_tp@vector.nsc.ru
Киселев Николай НиколаевичГосударственный научный центр вирусологии и биотехнологии «Вектор» (р.п. Кольцово, Новосибирская область)старший научный сотрудник лаборатории вирусологии флавивирусов отдела молекулярной вирусологии флавивирусов и вирусных гепатитовkiselev@vecto.nsc.ru
Чуб Елена ВладимировнаГосударственный научный центр вирусологии и биотехнологии «Вектор» (р.п. Кольцово, Новосибирская область)научный сотрудник лаборатории молекулярной эпидемиологии особо-опасных инфекций отдела молекулярной вирусологии флавивирусов и вирусных гепатитовchub@vector.nsc.ru
Тарасова Маргарита ВладимировнаГосударственный научный центр вирусологии и биотехнологии «Вектор» (р.п. Кольцово, Новосибирская область); Новосибирский государственный университет младший научный сотрудник лаборатории вирусологии флавивирусов отдела молекулярной вирусологии флавивирусов и вирусных гепатитов; кандидат биологических наук, научный сотрудник лаборатории бионанотехнологийtarasovamv@gmail.com
Святченко Виктор АлександровичГосударственный научный центр вирусологии и биотехнологии «Вектор» (р.п. Кольцово, Новосибирская область)кандидат биологических наук, зав. лабораторией вирусологии флавивирусов отдела молекулярной вирусологии флавивирусов и вирусных гепатитовsvyat@vector.nsc.ru
Терновой Владимир АлександровичГосударственный научный центр вирусологии и биотехнологии «Вектор» (р.п. Кольцово, Новосибирская область)кандидат биологических наук, зав. лабораторией молекулярной эпидемиологии особо опасных инфекций отдела молекулярной вирусологии флавивирусов и вирусных гепатитовtern@vector.nsc.ru
Всего: 10

Ссылки

Chanas A.C., Johnson B.K., Simpson D.I. Antigenic relationships of alphaviruses by a simple micro-culture cross-neutralization method // Journal of General Virology. 1976. Vol. 32. P. 295-300.
Вдовиченко Г.В., Петрищенко В.А., Сергеев А.А. и др. Доклинические исследования противоракового лечебного аденовирусного препарата «канцеролизин» // Вопросы вирусологии. 2006. № 6. C. 39-42.
O'Shea C.C., Johnson L., Bagus B. et al. Late viral RNA export, rather than p53 inactivation, determines 0NYX-015 tumor selectivity // Cancer cell. 2004. Vol. 6. P. 611-623.
Качко А.В. Святченко В.А., Терновой В.А. и др. Варианты аденовируса типа 5 с делециями в ранних генах: способность к селективной репликации в p53-дефекшых опухолевых клетках человека // Молекулярная биология. 2003. Т. 37. С. 868-875.
Bullenkamp J., Cole D., Malik F. et al. Human Gyrovirus Apoptin shows a similar subcel lular distribution pattern and apoptosis induction as the chicken anaemia virus derived VP3/ Apoptin // Cell death & disease. 2012. Vol. 3. P. e296.
Wu Y., Zhang X., Wang X. et al. Apoptin enhances the oncolytic properties of Newcastle disease virus // Intervirology. 2012. Vol. 55. P. 276-286.
Dong C.K., Masutomi K., Hahn W.C. Telomerase: regulation, function and transformation // Critical Reviews in Oncology/Hematology. 2005. Vol. 54. P. 85-93.
Li X., Liu Y., Wen Z. et al. Potent anti-tumor effects of a dual specific oncolytic adenovirus expressing apoptin in vitro and in vivo // Molecular cancer. 2010. Vol. 9. P. 10.
 Конструирование перспективных онколитических рекомбинантных аденовирусов, экспрессирующих ген белка апоптина | Вестн. Том. гос. ун-та. Биология. 2013. № 3 (23).

Конструирование перспективных онколитических рекомбинантных аденовирусов, экспрессирующих ген белка апоптина | Вестн. Том. гос. ун-та. Биология. 2013. № 3 (23).